JPhyloIO subversion repository

sventon subversion web client - http://www.sventon.org
[show recent changes]
 
  Help
Rev: HEAD (1671) - https://secure.bioinfweb.info/Code/svn/JPhyloIO / trunk / demo / info.bioinfweb.jphyloio.demo.eventwebview / data / examples / MEGA / MSALabels.meg
Show File - MSALabels.meg  [show properties]
spinner
#mega
!Title HSP 20 Aligned by MEGA 4;
!Format DataType=DNA indel=- CodeTable=Standard;
!Domain=Data property=Coding CodonStart=1;
#Rattus_norvegicus
GCAGGATGGAGATCCGGGTGCCTGTGCAGCCTTCTTGGCTGCGCCGTGCTTCAGCTCCTT
TACCGGGTTTTTCCACTCCGGGACGCCTCTTTGACCAGCGTTTCGGCGAAGGGCTGCTTG
#Homo_sapiens
10  ACTGCAACGCGGAGGAGCAGGATGGAGATCCCTGTGCCTGTGCAGCCGTCTTGGCTGCGC
11  CGCGCCTCGGCCCCGTTGCCCGGACTTTCGGCGCCCGGACGCCTCTTTGACCAGCGCTTC
12 
13  #Mus_musculus
14  GGCAGCGTAGGAACAGGATGGAGATCCCCGTGCCTGTGCAGCCTTCTTGGCTGCGCCGTG
15  CTTCAGCTCCTTTACCAGGTTTCTCTGCTCCGGGACGCCTCTTTGACCAGCGTTTCGGCG
16 
17  !Label
18  +++__-+++-a-+++-L-+++-k-+++123+++-_-+++---++++++__-+++-a-+++
19  -L-+++-k-+++123+++-_-+++---++++++__-+++-a-+++-L-+++-k-+++123;


feed icon

sventon 2.5.1

bioinfweb RSS feed JPhyloIO on ResearchGate bioinfweb on twitter JPhyloIO on GitHub

JPhyloIO poster ECCB 2016 Conference poster at ECCB Sep 2016

bioinfweb - Biology & Informatics Website